CpG oligodeoxynucleotides
Novus Biologicals | Catalog # NBP2-31134
Key Product Details
Species
Applications
Product Summary for CpG oligodeoxynucleotides
Human Sequence CpG ODN (2006) Type B: 5' T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3'
(* Indicates a phosphorothioate modification)
Negative Control oligo: 5' TGCTGCTTTTGTGCTTTTGTGCTT 3'
Functionality: This product is useful for the activation of TLR9 and the stimulation of TLR9 has been reported with 5-20 ug/ml.
Product Specifications
Specificity
Applications
In vitro assay (reported in scientific literature (PMID 25957979))
Ligand Activation (5-20 ug/ml)
Application Notes
Formulation, Preparation, and Storage
Formulation
Concentration
Shipping
Storage
Background: CpG oligodeoxynucleotides
Alternate Names
Additional CpG oligodeoxynucleotides Products
Product Documents for CpG oligodeoxynucleotides
Certificate of Analysis
To download a Certificate of Analysis, please enter a lot or batch number in the search box below.
Product Specific Notices for CpG oligodeoxynucleotides
This product is for research use only and is not approved for use in humans or in clinical diagnosis. Support products are guaranteed for 6 months from date of receipt.
Citations for CpG oligodeoxynucleotides
Customer Reviews for CpG oligodeoxynucleotides
There are currently no reviews for this product. Be the first to review CpG oligodeoxynucleotides and earn rewards!
Have you used CpG oligodeoxynucleotides?
Submit a review and receive an Amazon gift card!
$25/€18/£15/$25CAN/¥2500 for a review with an image
$10/€7/£6/$10CAN/¥1110 for a review without an image
Submit a review
FAQs
No product specific FAQs exist for this product.
View all FAQs for Supplemental Kits and Reagents