CpG oligodeoxynucleotides

Novus Biologicals | Catalog # NBP2-31134

Novus Biologicals
Loading...

Key Product Details

Species

Human

Applications

Functional Assay

Product Summary for CpG oligodeoxynucleotides

Human Sequence CpG ODN (2006) Type B: 5' T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3'

(* Indicates a phosphorothioate modification)

Negative Control oligo: 5' TGCTGCTTTTGTGCTTTTGTGCTT 3'

Functionality: This product is useful for the activation of TLR9 and the stimulation of TLR9 has been reported with 5-20 ug/ml.

Loading...

Product Specifications

Specificity

CpG ODN Type B (2006)

Applications

Functional (reported in scientific literature (PMID 25957979))
In vitro assay (reported in scientific literature (PMID 25957979))
Ligand Activation (5-20 ug/ml)

Application Notes

A TLR9/NF-kB SEAP reporter construct in a HEK 293 cell line was used as a model system for studying hTLR9 activation.

Formulation, Preparation, and Storage

Formulation

Sterile water

Concentration

Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance.

Shipping

The product is shipped with polar packs. Upon receipt, store it immediately at the temperature recommended below.

Storage

Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles.

Background: CpG oligodeoxynucleotides

Alternate Names

CpG ODN, CpG ODN (2006), oligodeoxynucleotides (ODN)

Additional CpG oligodeoxynucleotides Products

Product Documents for CpG oligodeoxynucleotides

Certificate of Analysis

To download a Certificate of Analysis, please enter a lot or batch number in the search box below.

Product Specific Notices for CpG oligodeoxynucleotides

This product is for research use only and is not approved for use in humans or in clinical diagnosis. Support products are guaranteed for 6 months from date of receipt.

Citations for CpG oligodeoxynucleotides

Customer Reviews for CpG oligodeoxynucleotides

There are currently no reviews for this product. Be the first to review CpG oligodeoxynucleotides and earn rewards!

Have you used CpG oligodeoxynucleotides?

Submit a review and receive an Amazon gift card!

$25/€18/£15/$25CAN/¥2500 for a review with an image

$10/€7/£6/$10CAN/¥1110 for a review without an image

Submit a review
Amazon Gift Card

FAQs

No product specific FAQs exist for this product.

View all FAQs for Supplemental Kits and Reagents
Loading...