CpG oligodeoxynucleotides Mouse

Novus Biologicals | Catalog # NBP2-31140

Novus Biologicals
Loading...

Key Product Details

Species

Mouse

Applications

Functional Assay

Product Summary for CpG oligodeoxynucleotides Mouse

Mouse Sequence CpG ODN (1585) Type A: 5' G*GGGTCAACGTTGAG*G*G*G*G*G 3'

(* Indicates a phosphorothioate modification)

Functionality: This product is useful for the activation of TLR9 and the stimulation of TLR9 has been reported with 5-20 ug/ml.

Loading...

Product Specifications

Specificity

CpG ODN Type A (1585)

Applications

Ligand Activation (5-20 ug/ml)

Application Notes

A TLR9/NF-kB SEAP reporter construct in a HEK 293 cell line was used as a model system for studying hTLR9 activation.

Formulation, Preparation, and Storage

Formulation

Sterile water

Concentration

Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance.

Shipping

The product is shipped with polar packs. Upon receipt, store it immediately at the temperature recommended below.

Storage

Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles.

Background: CpG oligodeoxynucleotides Mouse

Alternate Names

CpG oligodeoxynucleotides (ODN), ODN

Additional CpG oligodeoxynucleotides Mouse Products

Product Documents for CpG oligodeoxynucleotides Mouse

Certificate of Analysis

To download a Certificate of Analysis, please enter a lot or batch number in the search box below.

Product Specific Notices for CpG oligodeoxynucleotides Mouse

This product is for research use only and is not approved for use in humans or in clinical diagnosis. Support products are guaranteed for 6 months from date of receipt.

Customer Reviews for CpG oligodeoxynucleotides Mouse

There are currently no reviews for this product. Be the first to review CpG oligodeoxynucleotides Mouse and earn rewards!

Have you used CpG oligodeoxynucleotides Mouse?

Submit a review and receive an Amazon gift card!

$25/€18/£15/$25CAN/¥2500 for a review with an image

$10/€7/£6/$10CAN/¥1110 for a review without an image

Submit a review
Amazon Gift Card

Protocols

View specific protocols for CpG oligodeoxynucleotides Mouse (NBP2-31140):

CpG oligodeoxynucleotides Mouse (1585):
Hazard Information
Chemical Name: ODN 1668
Chemical Formula: CpG ODN- 5' TCCATGACGTTCCTGACGTT 3' (in bold is phosphorothiate linkage)
CAS Number: N/A
EEC-No: N/A

First Aid Measures
Eye Contact: May cause eye irritation.
Skin Contact: May cause skin irritation. May be harmful if absorbed through the skin.
Inhalation: May causes respiratory tract irritation. May be harmful if inhaled.
Ingestion: May be harmful if swallowed.

Fire Fighting Measures
Special risks: N/A
Suitable Extinguish Media: Water spray, carbon dioxide, dry chemical powder or appropriate foam.

Accidental Release Measures
Eyes: Immediately flush eyes with plenty of water for at least 15 minutes, occasionally lifting the upper and lower eyelids. Consult a physician.
Skin: Get medical aid immediately. Immediately flush skin with plenty of water for at least 15 minutes while removing contaminated clothing and shoes. SPEEDY ACTION IS CRITICAL!
Ingestion: If swallowed, get medical aid immediately. Only induce vomiting if directed to do so by medical personnel. Never give anything by mouth to an unconscious person.
Inhalation: Remove from exposure and move to fresh air immediately. If breathing is difficult, give oxygen. SPEED IS ESSENTIAL, OBTAIN MEDICAL AID IMMEDIATELY. Do not use mouth-to-mouth resuscitation if victim ingested or inhaled the substance; induce artificial respiration with the aid of a pocket mask equipped with a one-way valve or other proper respiratory medical device.
Notes: Consult a physician. Show this safety data sheet to the physician. Move away from the dangerous area.

Handling and Storage
Handling: Avoid contact with eyes, skin and clothing. Avoid prolonged or repeated exposure. Avoid inhalation. Use personal protective equipment (i.e. impermeable gloves, lab coat or apron).
Store at -20 degrees C. Store in a tightly closed container. Stable under recommended storage conditions

Exposure Controls / Personal Protection
Physical and Chemical Properties
Form: Powder
Color: Colorless
Odor: Odorless
Melting Point: No data available
Boiling Temperature: No data available
Density: No data available
Vapor Pressure: No data available
Solubility in Water: Very soluble
Flash Point: No data available
Explosion limits: No data available
Ignition Temperature: No data available

Stability and Reactivity
Stability: Stable
Hazardous Polymerization: Will not occur.
Materials to avoid: Strong oxidizing agents.
Hazardous Decomposition Products: Decomposition products are not hazardous.
HMIS Classification: Health Hazard 0, Flammability Hazard 0, Reactivity Hazard 0
NFPA Rating: Health Hazard 0, Fire 0, Reactivity Hazard 0.

Disposal Considerations
Observe all federal, state, and local environmental regulations. Contact a licensed professional waste disposal service to dispose of this material. Must not be disposed together with household garbage.

Other Information
The information contained in this material safety datasheet is believed to be accurate but it is the responsibility of the user or supplier to determine the applicability of these data to the formulation of necessary safety precautions.
NOVUS shall not be held responsible for any damage resulting from the use of the above product or the information contained in this material safety data sheet.

FAQs

No product specific FAQs exist for this product.

View all FAQs for Supplemental Kits and Reagents
Loading...