Recombinant F. tularensis Cpf1 Protein, CF

R&D Systems | Catalog # 10343-C1

R&D Systems
Loading...

Key Product Details

  • R&D Systems E. coli-derived Recombinant F. tularensis Cpf1 Protein (10343-C1)
  • Quality control testing to verify active proteins with lot specific assays by in-house scientists
  • All R&D Systems proteins are covered with a 100% guarantee

Source

E. coli

Accession Number

Applications

Enzyme Activity
Loading...

Product Specifications

Source

E. coli-derived f. tularensis Cpf1 protein
APKKKRKVGIHGVPAA F. tularensis Cpf1
(Ser2-Asn1300)
Accession # WP_003034647.1
KRPAATKKAGQAKKKKGG HHHHHH
N-terminus C-terminus

Purity

>90%, by SDS-PAGE visualized with Silver Staining and quantitative densitometry by Coomassie® Blue Staining.

Endotoxin Level

<0.10 EU per 1 μg of the protein by the LAL method.

N-terminal Sequence Analysis

Ala

Predicted Molecular Mass

156 kDa

SDS-PAGE

110-135 kDa, under reducing conditions

Activity

Measured by its ability to cleave a targeted DNA substrate.
rF. tularensis Cpf1 achieves >80% substrate cleavage, as measured under the described conditions.

Scientific Data Images for Recombinant F. tularensis Cpf1 Protein, CF

Recombinant F. tularensis Cpf1 Protein SDS-PAGE

Recombinant F. tularensis Cpf1 Protein SDS-PAGE

2 μg/lane of Recombinant HumanF. tularensisCpt1 Protein (Catalog # 10343-C1) was resolved with SDS-PAGE under reducing (R) and non-reducing (NR) conditions and visualized by Coomassie® Blue staining, showing bands at 110-135 kDa.

Formulation, Preparation, and Storage

10343-C1
Formulation Supplied as a 0.2 μm filtered solution in Tris, NaCl, EDTA, Glycerol and TCEP.
Shipping The product is shipped with polar packs. Upon receipt, store it immediately at the temperature recommended below.
Stability & Storage Use a manual defrost freezer and avoid repeated freeze-thaw cycles.
  • 6 months from date of receipt, -20 to -70 °C as supplied.
  • 3 months, -20 to -70 °C under sterile conditions after opening.

Background: Cpf1

Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated endonuclease from Prevotella and Francisella 1, Cpf1, also known as Cas12a, is a  1200-1500 amino-acids long monomeric protein that belongs to the CRISPR/Cas system (1, 2), an adaptive immune system of prokaryotes that has now become a powerful tool for genome editing (3). CRISPR/Cpf1 belongs the class II (type 5) of the CRISPR/Cas system that is defined by a single-subunit effector (4). Cpf1 has recently emerged as an alternative for Cas9, due to its distinct features (2, 5) such as the ability to target T-rich motifs, no need for trans-activating crRNA, inducing a staggered double-strand break and potential for both RNA processing and DNA nuclease activity. In addition, Cpf1 is able to process more structured pre-CRISPR/RNA(crRNA) molecules into mature crRNAs (6) which allows the possibility to use both mature or pre-crRNA for genome editing purposes(7). All these features make the CRISPR-Cpf1 system a valuable genome-engineering tool (8). CRISPR-Cpf1(Cas12a) has been successfully used to edit genomes in mammalians cells (2), plants (9), mice (10), Drosophila (11) and recently zebrafish and Xenopus (7). Two Cpf1 orthologs have been commonly used for genome editing in different organisms: AsCpf1 and LbCpf1, which are derived from Acidaminococcus sp. BV3L6 and Lachnospiraceae bacterium ND2006, respectively (8).The attached nuclear localization signals (NLSs) on the chimeric protein ensures nuclear compartmentalization in cells during gene editing (12).

References

  1. Jinek, M. et al. (2012) Science 337:816.
  2. Zetsche, B. et al. (2015) Cell 163:759.
  3. Sandler J.D. and Joung J.K. (2014) Nat Biotechnol. 32:347.
  4. Koonin E.V. et al. (2017) Curr. Opin. Micrbiol. 37:67.
  5. Bayat H. et al. (2018) Curr. Micribiol. 75:107.
  6. Fonfara, I. et al. (2016) Nature 532:517.
  7. Moreno-Mateo, M.A. et al. (2017) Nat. Commun 8:2024.
  8. Joung K.J. et al. (2016) Nat. Biotechnol. 34:869.
  9. Kim, H et al. (2017) Nat. Commun. 8:14406.
  10. Kim, Y. et al. (2016) Nat. Biotechnol. 34:808.
  11. Port, F. and Bullock, S.L. (2016) Nat Methods 13:852.
  12. Cong, L. et al. (2013) Science 339:819.

Long Name

CRISPR-associated Endonuclease Cas12a

Alternate Names

Cas12a

UniProt

Additional Cpf1 Products

Product Documents for Recombinant F. tularensis Cpf1 Protein, CF

Certificate of Analysis

To download a Certificate of Analysis, please enter a lot or batch number in the search box below.

Note: Certificate of Analysis not available for kit components.

Product Specific Notices for Recombinant F. tularensis Cpf1 Protein, CF

For research use only

Customer Reviews for Recombinant F. tularensis Cpf1 Protein, CF

There are currently no reviews for this product. Be the first to review Recombinant F. tularensis Cpf1 Protein, CF and earn rewards!

Have you used Recombinant F. tularensis Cpf1 Protein, CF?

Submit a review and receive an Amazon gift card!

$25/€18/£15/$25CAN/¥2500 Yen for a review with an image

$10/€7/£6/$10CAN/¥1110 Yen for a review without an image

Submit a review
Amazon Gift Card

Protocols

View specific protocols for Recombinant F. tularensis Cpf1 Protein, CF (10343-C1):

Materials
  • Assay Buffer: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 µg/ml BSA, pH 7.9
  • Recombinant F. tularensis Cpf1 (rF.t.Cpf1) (Catalog # 10343-C1)
  • DNA Substrate: PBR322 vector (NEB, Catalog # N3033S) digested with EcoRI-HF (NEB, Catalog # R3101S)*
  • Integrated DNA Technologies (IDT) Alt-R Cpf1 crRNA, targeting sequence: TGCCGCCTCGGCGAGCACAT
  • Ultrapure DNase/RNase-Free Distilled Water (Invitrogen, Catalog # 10977015), to prepare Assay Buffer
  • DNA gel
  • TAE Buffer, 25X Liquid Concentrate (VWR, Catalog # 97062-386)
  • Ethidium Bromide, 10 mg/mL (Amresco, Catalog # X328)

*Digest was gel purified using gel purification kit and eluted in EB buffer (10 mM Tris-HCl, pH 8.5).

  1. Prepare RNP Complex:
    a. 200 nM crRNA (2 µL addition from 3 µM stock prepared in Assay Buffer)
    b. 0.35 µg rF.t.Cpf1
    c. Add Assay Buffer for a final RNP Complex volume of 23 µL
    d. Incubate for 5 minutes at 25 °C
  2. Mix RNP Complex with 7 µL of 8.6 ng/µL of DNA Substrate (diluted in Assay Buffer, if possible).
  3. Incubate for 20 minutes at 37 °C.
  4. Incubate for 10 minutes at 65 °C to dissociate enzyme from DNA.
  5. Load total reaction with loading dye on a 1.25% agarose gel.
  6. Run gel at 140V for 40 minutes.
  7. Soak gel in 200 mL of 1X TAE Buffer with 150 µL of 10 mg/mL Ethidium Bromide for 1 hour.
  8. Use imaging software to detect and quantify hydrolysis of the DNA substrate.
Per Reaction:
  • rF.t.Cpf1: 0.35 µg
  • DNA Substrate: 60 ng
  • crRNA: 200 nM

FAQs

No product specific FAQs exist for this product.

View all FAQs for Proteins and Enzymes
Loading...