Recombinant S. pyogenes CRISPR-associated Protein 9, CF

R&D Systems | Catalog # 9957-C9

Purified CAS9 with Nuclear Localization Sequence
R&D Systems
100% Guarantee

Key Product Details

  • R&D Systems E. coli-derived Recombinant S. pyogenes CRISPR-associated Protein 9 (9957-C9)
  • Quality control testing to verify active proteins with lot specific assays by in-house scientists
  • All R&D Systems proteins are covered with a 100% guarantee

Source

E. coli

Applications

Enzyme Activity
View all CRISPR-Cas9 Proteins and Enzymes »

Product Specifications

Source

E. coli-derived s. pyogenes CRISPR-Cas9 protein
APKKKRKVGIHGVPAA S. pyogenes CRISPR-Cas9
(Asp2-Asp1368)
Accession # Q99ZW2		 KRPAATKKAGQAKK-KKGYGRKKRRQRRRG HHHHHH
N-terminus C-terminus

Purity

>95%, by SDS-PAGE visualized with Silver Staining and quantitative densitometry by Coomassie® Blue Staining.

Endotoxin Level

<0.10 EU per 1 μg of the protein by the LAL method.

N-terminal Sequence Analysis

Ala

Predicted Molecular Mass

164 kDa

SDS-PAGE

133 kDa, reducing conditions

Activity

Measured by its ability to cleave a targeted DNA substrate.
S. pyogenes CRISPR-Cas9 achieves >80% substrate cleavage, as measured under the described conditions.

Scientific Data Images for Recombinant S. pyogenes CRISPR-associated Protein 9, CF

Recombinant S. pyogenes CRISPR-associated Protein 9 Bioactivity

Recombinant S. pyogenes CRISPR-associated Protein 9 Bioactivity

Quantitative analysis of the substrate cleavage by densitometry of the agarose gel. Error bars display standard error of 3 replicates. 9957-C9 has equivalent activity to a Leading Competitor's Cas9 using the insert assay protocol.
Recombinant S. pyogenes CRISPR-associated Protein 9 Bioactivity

Recombinant S. pyogenes CRISPR-associated Protein 9 Bioactivity

Agarose gel image of in vitro cleavage of DNA substrate into two DNA products by 9957-C9 and a Leading Competitor's Cas9.
Recombinant S. pyogenes CRISPR-associated Protein 9 SDS-PAGE

Recombinant S. pyogenes CRISPR-associated Protein 9 SDS-PAGE

2 μg/lane of Recombinant S. pyogenes CRISPR-Cas9 was resolved with SDS-PAGE under reducing (R) and non-reducing (NR) conditions and visualized by Coomassie® Blue staining, showing a band at ~130 kDa.

Formulation, Preparation, and Storage

9957-C9
Formulation Supplied as a 0.2 μm filtered solution in Tris, NaCl, EDTA, Glycerol and TCEP.
Shipping The product is shipped with polar packs. Upon receipt, store it immediately at the temperature recommended below.
Stability & Storage Use a manual defrost freezer and avoid repeated freeze-thaw cycles.
  • 6 months from date of receipt, -20 to -70 °C as supplied.
  • 3 months, -20 to -70 °C under sterile conditions after opening.

Background: CRISPR-Cas9

Streptococcus pyogenes Cas9 (CRISPR associated protein 9) is a 160 kDa RNA guided endonuclease that introduces site specific cleavage of double strand DNA (1). It is part of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) system found in many bacteria such as S. pyogenes and most archaea, which provide adaptive immunity against invading mobile genetic elements (such as viruses, transposable elements and conjugative plasmids) (2, 3). Upon viral infection, short viral DNA (known as "spacers") integrate into the host genome between CRISPR repeats, and RNA sequences (guide RNA or gRNA) with this genetic information help guide Cas9 protein to recognize and cut foreign DNA. Cas9 protein undergoes conformational changes upon gRNA binding that shift from non-DNA binding conformation into an active DNA binding conformation. In the Cas9-gRNA complex, the gRNA sequence remains accessible to interact with free DNA, and the extent to which the gRNA spacer and target DNA segment (known as "protospacer") match will determine the cut site (4). The presence of a 5′-NGG-3′ protospacer adjacent motif (PAM) sequence immediately downstream of protospacers is required for Cas9 cleavage of the foreign DNA. PAM is absent in bacterial CRISPR loci, therefore preventing cleavage of the host genome (4). Cas9 associates with other proteins of the acquisition machinery (Cas1, Cas2 and Csn2), presumably to provide PAM specificity to this process (5). This RNA guided nuclease system called CRISPR/Cas (CRISPR associated protein) has been widely applied to genome engineering with increased efficiency (6). The attached nuclear localization signals(NLSs) on the chimeric protein ensures nuclear compartmentalization in mammalian cells during gene editing (7).

References

  1. Feng, Z. et al. (2013) Cell 154:1380.
  2. Moineau. et al. (2010) Nature 468:67.
  3. Barrangou, R. et al. (2014) Molecular Cell 54:234.
  4. Charpentier, E. et al. (2011) Nature 471:602.
  5. Heler, R. et al. (2015) Nature 519:199.
  6. Thomson, J.A. et al. (2013) PNAS,110:15644.
  7. Cong, L. et al. (2013) Science 339:819.

Long Name

CRISPR-associated Protein 9

Alternate Names

Cas9, CRISPR-associated endonuclease Cas9/Csn1, CRISPR-Cas9/Csn1, CRISPR/Cas9, csn1, SPy_1046, SPy1046, SpyCas9

Entrez Gene IDs

901176 (S. pyogenes)

Gene Symbol

CAS9

Additional CRISPR-Cas9 Products

Product Documents for Recombinant S. pyogenes CRISPR-associated Protein 9, CF

Certificate of Analysis

To download a Certificate of Analysis, please enter a lot or batch number in the search box below.

Note: Certificate of Analysis not available for kit components.

Download SDS

Product Specific Notices for Recombinant S. pyogenes CRISPR-associated Protein 9, CF

For research use only

Customer Reviews for Recombinant S. pyogenes CRISPR-associated Protein 9, CF

There are currently no reviews for this product. Be the first to review Recombinant S. pyogenes CRISPR-associated Protein 9, CF and earn rewards!

Have you used Recombinant S. pyogenes CRISPR-associated Protein 9, CF?

Submit a review and receive an Amazon gift card!

$25/€18/£15/$25CAN/¥2500 Yen for a review with an image

$10/€7/£6/$10CAN/¥1110 Yen for a review without an image

Submit a review
Amazon Gift Card

Protocols

View specific protocols for Recombinant S. pyogenes CRISPR-associated Protein 9, CF (9957-C9):

Materials
  • Assay Buffer: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 µg/mL BSA, pH 7.9
  • Recombinant Streptococcus pyogenes CRISPR-Cas9 (rS. pyogenes Cas9) (Catalog # 9957-C9)
  • PBR322 vector (NEB, Catalog # N3033S) digested with EcoRI-HF (NEB, Catalog # R3101S)*
  • Dharmacon synthetic sgRNA, targeting sequence: GAGGCAGACAAGGTATAGGG
  • Ethidium Bromide, 10 mg/mL (Amresco, Catalog # X328)
  • Ultrapure DNase/RNase-Free Distilled Water (Invitrogen, Catalog # 10977015), to prepare Assay Buffer
  • DNA gel

*Digest was gel purified using gel purification kit and eluted in EB buffer (10 mM Tris-HCl, pH 8.5).

  1. Prepare RNP Complex:
    a. 600 nM sgRNA (6 µL addition from 3 µM stock prepared in Assay Buffer)
    b. 0.25 μg rS. pyogenes Cas9
    c. Add Assay Buffer for a final RNP Complex volume of 26.5 µL
    d. Incubate for 5 minutes at 37 °C.
  2. Mix RNP Complex with 3.5 μL of 8.6 ng/µL of DNA Substrate (diluted in Assay Buffer, if possible).
  3. Incubate for 1 hour at 37 °C.
  4. Incubate for 10 minutes at 65 °C to dissociate enzyme from DNA.
  5. Load total reaction with loading dye on a 1% agarose gel.
  6. Run gel at 140 V for 40 minutes.
  7. Soak gel in 200 mL TAE with 150 μL of 10 mg/mL ethidium bromide for 1 hour.
  8. Use imaging software to detect and quantify hydrolysis of the DNA substrate.
Per Reaction:
  • rS. pyogenes Cas9: 0.25 μg
  • DNA Substrate: 30 ng
  • sgRNA: 600 nM

FAQs

No product specific FAQs exist for this product.

View all FAQs for Proteins and Enzymes